Thursday, November 12, 2009

Familial Hypomagnesemia with Hypercalciuria and Nephrocalcinosis: Unusual Clinical Associations and Novel Claudin16 Mutation in an Egyptian family

Original Article

Familial Hypomagnesemia with Hypercalciuria and Nephrocalcinosis: Unusual Clinical Associations and Novel Claudin16 Mutation in an Egyptian family


Mohammad Al-Haggar a, Ashraf Bakr b, Toshihiro Tajima c, Kenji Fujieda d, Ayman Hammad b, Othman Soliman a, Ahmad Darwish b, Afaf Al-Said a, Sohier Yahia a, Dina Abdel-Hady a


a Genetics Unit, Mansoura University Children's Hospital, Mansoura, Egypt
b Nephrology Unit, Mansoura University Children's Hospital, Mansoura, Egypt
c Department of Pediatrics, Hokkaido University School of Medicine, Japan
d Department of Pediatrics, Asahikawa Medical College, Japan

Correspondence: Mohammad Al-Haggar, MD., Genetics Unit, Mansoura University Children's Hospital, Mansoura, Egypt
Phone: +2050 2211948, +20502310661, +20111715350, Fax: +20502234092
Email: m.alhaggar@yahoo.co.uk

Abstract.
Background: Familial hypomagnesemia with hypercalciuria and nephrocalcinosis (FHHNC) is a rare autosomal recessive tubular disorder that eventually progresses to renal failure depending upon extent of nephrocalcinosis. Its basic pathogenesis is impaired tubular resorption of magnesium and calcium in thick ascending limb of loop of Henle (TAL) which is due to a genetic defect in paracellin-1 (a tight junction protein expressed in TAL). Mutations of Claudin16 gene (CLDN16), formerly called paracellin-1 gene (PCLN-1), have been linked to FHHNC.
Methods: An extended Egyptian family with more than one member affection by nephrocalcionsis was included and thoroughly investigated in the current study after taking an informed consent. Thorough history taking for polyuria, polydipsia and hypocalcemia symptoms, as well as clinical examination with stress on anthropometric measurements and radiological evaluation for kidneys and bones. Laboratory work up for differential diagnosis of nephrocalcinosis was done: complete urinalysis including urinary calcium excretion, urine pH and electrolytes, arterial blood gas (ABG), serum electrolytes (sodium, potassium, calcium, magnesium and phosphorous), renal function tests as well as parathyroid and gonadotropin-sex hormone assay. DNA extraction from peripheral blood leukocytes was done followed by amplification using primers previously described, purification and finally sequencing to analyze each exon of the CLDN16 gene.
Results: Two sibs for a consanguineous couple were affected by nephrocalcinosis and showed persistent hypocalcemia, hypercalciuria, nephrocalcinosis with persistently alkaline urine, and ocular manifestations in the form of congenital cataract, high myopia and retinal abnormalities. The elder sib showed genitourinary abnormalities in the form of hypospadias and cryptorchidism. These two sibs had homozygous two bases deletion in exon 1 of CLDN16 gene (C. 233_234 del GG; Ins C) causing a frame shift mutation (Arg55fs), however their parents were heterozygote carriers for that mutation.
Conclusion: The above mentioned clinical data in the two affected sibs together with family history of end stage renal disease associated with nephrocalcinosis and high myopia suggest diagnosis of FHHNC which had been confirmed, for the first time in an Egyptian family, by a novel mutation in exon 1 of CLDN16 gene. Genitourinary associations with FHHNC had not been reported in literatures yet. Currently, we will try to highlight the principles of mutations detection based on sequencing with the use of the online NCBI databases, statistics and other search tools.
Keywords: Familial hypomagnesemia with hypercalciuria and nephrocalcinosis, Paracellin-1, CLDN16.

Introduction:
Nephrocalcinosis which means a generalized increase in the renal calcium content is usually incidentally detected and is not uncommon in the hospital practice. Depending upon its location it could be cortical which is rare, however the medullary form constitutes 98% of cases of nephrocalcinosis. The most common causes of nephrocalcinosis are hyperparathyroidism, distal tubular acidosis, idiopathic hypercalciuria and hyperoxaluria. Familial hypomagnesemia with hypercalciuria and nephrocalcinosis (FHHNC - OMIM 248250) is a rare autosomal recessive disorder characterized by hypomagnesemia, hypercalciuria and nephrocalcinosis which can result in end stage renal disease (ESRD) with the need for renal replacement therapy in about 50% of cases; usually in the second decade of life (1-3). The only known cure is renal transplantation, however symptomatic treatment in the form of magnesium citrate and calcium replacements, or the use hydrochlorothiazide only delays the onset of ESRD (4).
FHHNC was first described in 1972 (5), its frequent initial symptoms include recurrent urinary tract infections, polyuria and polydipsia, in addition to marked hypomagnesemia; all cases exhibit hypercalciuria and nephrocalcinosis. Additional symptoms include nephrolithiasis, abdominal pain, convulsions, muscular twitches, failure to thrive, incomplete distal renal tubular acidosis and hypocitraturia (6-8). Some authors reported elevated serum parathyroid hormone (PTH) levels early in the course of the disease, independently of glomerular filtration rate (GFR) (8). Ocular abnormalities and hearing impairment have been reported as inconsistent extra-renal findings (9).
Mutations in the Claudin-16 gene (CLDN16, previously called paracellin-1; PCLN-1 gene), have been linked to FHHNC; it encodes a tight junction protein (Paracellin-1), member of Claudin family, which is expressed in the tight junctions of thick ascending limb (TAL) of loop of Henle. It has 4 transmembrane domains and 2 extracellular loops. It is speculated that PCLN-1 might be a paracellular ion channel or might be involved in regulating paracellular ion conductance. Unlike in the distal convoluted tubule where the bulk of calcium absorption is across the epithelial cell, cation transport in TAL is largely paracellular driven by lumen positive electric potential. To date 24 different PCLN-1 mutations were identified (4); most of these mutations (67%) were missense although deletions and frame shift mutations were also reported. Most mutations occur in the transmembrane and extracellular domains; the first extracellular loop of PCLN-1 was the region most often affected by single nucleotide exchange. Thus it is plausible that these mutations interfere with the function of the paracellular barrier and lead to abnormalities of transport in TAL, a major site for calcium and magnesium reabsorption (4, 10, 11).
In the current study we reported the clinical course of two affected sibs who were product of a consanguineous Egyptian couple; they were accidentally discovered by ultrasonographic findings of nephroclcinosis; analysis of CLDN16 (PCLN-1) gene revealed that the 2 sibs were homozygous for two bases deletion in exon 1 (C. 232_235 delGGinsC) causing a frame shift mutation (Arg55fs), their parents were carriers for the same mutation.

Patients and Methods:
An extended multi-generation Egyptian family with more than one member affection by nephrocalcionsis was included and thoroughly investigated in the current study after taking an informed consent from patients or their guardians. This family was referred to our hospital; Mansoura University Children's Hospital (MUCH) at December 2007, due to the presentation of probands (1201 and 1202); polyuria, polydipsia, vomiting, failure to thrive and tetanic seizures. Both sibs were born of full term normal delivery. Probands as well as all members were subjected to thorough history taking and clinical examination with stress on anthropometric measurements and radiological work up for kidneys and bones. Laboratory work up for consideration of the different causes of nephrocalcinosis had been done: complete urinalysis including urinary calcium, urine pH and electrolytes, arterial blood gas (ABG), serum electrolytes (sodium, potassium, calcium, magnesium and phosphorous), renal function tests and parathyroid hormone level. The older sib showed some genito-urinary abnormalities (hypospadias and crypotorchidism) for which he underwent hormonal assay of the goandotropin-sex steroid axis (testosterone, dihydrotestesterone, follicle stimulating hormone; FSH, and lutenizing hormone; LH).
DNA extraction from peripheral blood leukocyte samples was done using the DNA purification Capture Column Kit (Gentra kit). DNA amplification and sequence analysis had been performed. Each exon of the CLDN16 gene was amplified by polymerase chain reaction (PCR) using primers previously described (1, 12). The PCR conditions consisted of 9 min at 94oC followed by 30 cycles of 30 s at 94oC, 30 s at 52oC, and 30 s at 72oC in a Perkin-Elmer Gene Amp PCR System 2400 thermal cycler (PE Applied Biosystems, Foster City, Calif., USA). After amplification, the PCR products were purified from low-melting agarose gel, and the purified products were sequenced directly with an ABI PRISM Dye Terminator Cycle Sequencing Kit and an ABI 373A automated fluorescent sequencer (PE Applied Biosystems).

Results:
The two sibs (1201, 1202) were born for a consanguineous Egyptian couple (second cousins), they had no history of urinary problems, clinical evidence of skeletal or dental abnormalities, abdominal ultrasonography demonstrated bilateral nephrocalcinosis in both sibs (Fig. 1). Eye signs included high myopia and retinal abnormalities (hyperpigmentation and whitish patches) with bilateral congenital cataract in the older sib (1201) for which he underwent surgery. Sib 1201 who had previous surgery for hypospadias and cryptorchidism showed within normal range hormonal profile that assessed the gonadotropin-sex steroid axis (testosterone, dihydrotestesterone, FSH, LH). Multigeneration pedigree is shown in (Fig. 2) demonstrating the consanguineous relationship and route of carriage form grandparents. The two probands (1201, 1202) as well as their consanguineous parents (1101, 1102) were thoroughly evaluated biochemically and molecularly, however there were other four affected members, product of a non-consanguineous couple, they were proved to have nephrocalcinosis, but no blood sample was available for further biochemical and DNA analysis.
Both sibs (1201, 1202) had persistent hypocalcemia, hypercalciuria, alkaline urine, hypomagnesemia, with no evidence of other urinary losses (glycosuria or aminoaciduria) but with secondary hyperparathyroidism. Renal function was normal in both sibs at time of diagnosis (serum creatinine 0.6 and 0.5 mg/dL respectively, glomerular filteration rate (GFR) according to Schwartz formula was 110-115 mL/min/1.73 M2). Summary of clinical and biochemical profile is shown in (Table 1). Hypokalemia found in case 1202 could be explained by the nephrogenic diabetes insipidus, however the use of thiazides in combination with salt restriction for treatment of polyuria in such situation may be the possible factors explaining hyponatremia found in both cases (1201, 1202). PTH level was higher in both sibs than normal; being eight folds higher in 1202 compared to 1201; this disparity could be attributed to the early start of treatment in the older sib (1201).
Skeletal survey, ear, nose and throat evaluation were unremarkable. Parents (1101, 1102) showed uneventful urine analysis, blood biochemistry, serum magnesium and imaging studies.
With the aforementioned data, diagnosis of FHHNC had been entertained and genetic testing for CLDN16 muataion was confirmatory (see below). Both sibs were treated with sodium bicarbonate, thiazide diuretic, calcitriol and calcium carbonate; they are still on regular outpatient follow up in MUCH, Egypt.


Mutation analysis of CLDN16:
Tabulation of the codant part of exon-1 (from its initiator codon at bp 69 to its end at bp 392), showed that this exon is normally translated to 108 amino acids [http://www.genatlas]. We used the online statistical engine; BLAST (Basic Local Alignment Search Tool) provided by NCBI (National Center for Biotechnical Information) for aligning purposes (13). About 40-44 bases flanking the sequenced query segment (Fig. 3, 4) were entered and compared with their reference sequence in human genome.
BLAST summary result: [http://blast.ncbi.nlm.nih.gov/Blast/]


The affected Siblings (1201, 1202):claudin 16Score= 56.0 bits (28), Expect= 1e-06, Identities= 38/40 (95%), Gaps= 1/40 =2% Query sequence AGTGGGGCCAGC-CTGGTGTCTGCCCATGTTGCCATCCT Subject 96601212 AGTGGGGCCAGGGCTGGTGTCTGCCCATGTTGCCATCCT 96601251 Comment:Codon 55 AGG (Arginine) à AGC (Serine); missense mutation.Codon 56 GCT (Alanine) à -CT i.e. del G; causing changes of the whole reading frame i.e. (Frame shift mutation).

We can conclude that in these patients, codons 55 & 56 (AGG GCT) were changed into (AGC -CT); therefore the nomenclature of this mutation according to recommendations of den Dunnen and Antonarakis (14), will be as follow:
1. At the DNA level:- There is combined insertion/deletions (indels) named as C.232_235 delGGinsC; denotes deletion of nucleotides GG (233, 234) and insertion C.
2. At the protein level:- Arg55fs (Frame shift mutation starting just after codon 55 that codes for arginine (due to C.234 del G; deletion of the first nucleotide G in codon 56) causing change of the whole reading frame (Fig. 3). This frameshift mutation has been indexed in [http://www.ncbi.nlm.nih.gov/RefSeq] as follow:
Contig pos
mRNA orientation
mRNA pos
Function
Nucleotide pos
Amino acid pos
96601224
Forward
234
Frame shift
1
56

Moreover, Weber et al (2000) have documented this frameshift mutation (Arg55fs); they reported two consanguineous but unrelated families (family 4 and 8) of different ethnic origin demonstrating a homozygous frame shift mutation that affected the N-terminal part of PCLN-1 causing a nonsense amino acid sequence from amino acid position 55 to 89 (1). The unique feature found in mutation described in this current report is the coexistence of missense mutation in codon 55 just before the frame shift mutation (Arg 55 Ser), therefore, nomenclature of our complex mutation will be Arg/Ser55fs.
Mutation analysis of both parents at that site [C. 232_235] which is assigned by arrows (Fig. 4); showed double bands; one coincident with the reference sequence entered manually and the other was identical to the mutant allele found in affected sibs, so parents were considered to be heterozygote carriers for that mutation. The four affected sibs of the non-consanguineous couple, although not analyzed molecularly, could be explained by the founder effect as the family is routed from a small community with high inbreeding.

Discussion:
FHHNC is an autosomal recessive disorder firstly described 1972 (5); its cardinal features include renal wasting of magnesium and calcium associated with the development of nephrocalcinosis and/or renal stones in early childhood. In any patient with renal calcium leak, there will be secondary hyperparathyroidism, so serum PTH level is expectedly high in FHHNC patients. The usual presenting features of this disorder are polyuria, excessive thirst, tetanic seizures, muscle cramps and muscle weakness due to magnesium deficiency. Additional manifestations include failure to thrive, recurrent urinary tract infections, growth retardation, rickets, renal stones, abdominal colic and incomplete distal tubular acidosis (9). Increased urinary calcium excretion, magnesium deficiency and urinary acidification defects account for the tendency towards nephrocalcinosis and nephrolithiasis in FHHNC (15).
A spectrum of extra-renal associations had been reported with FHHNC; these include ocular manifestations in almost half of cases and hearing impairment in about 10% (9). Ocular involvements are usually in the form of myopia and macular colobomata, however nystagmus and tapeto-retinal degeneration were also described. Bilateral cataract reported in sib (1201) could be sequel of prolonged hypocalcemia rather than a mere association. It is currently not known whether PCLN-1 gene is also expressed in eye (4).
Parental consanguinity was noted in 6 out of 35 families; none of the parents had full blown clinical picture, however abnormal renal findings such as isolated hypercalciuria or renal stones were discovered in 16 out of 23 families (1). In the current study, although parents were proven to be heterozygote carriers of the currently described mutation, none of them showed any clinical or laboratory evidence of renal transport defect.
Most patients with FHHNC progress to ESRD; renal failure often occurs in the second or third decade of life. The severity of nephrocalcinosis is usually correlated with rapid progression to ESRD but this association was disputed in some literatures (4, 8, 16-18). Tubulopathies accompanied by nephrocalcinosis are not uniformly progressing to renal failure; for example in distal tubular acidosis and Bartter' syndrome, GFR is usually not impaired despite severe nephrocalcinosis. Therefore additional unidentified factors seem to be important for the development of renal failure in cases of FHHNC (16). In the current report, our cases (1201, 1202) still have normal renal function perhaps due to their young age; they were put on the conventional therapeutic measures; continuous administration of magnesium supplements, thiazides to reduce hypercalciuria, however serum magnesium remains lower than normal and renal calcium leak continues. Theoretically these measures have no impact on the ultimate development of renal failure and renal transplant should be the only definitive therapy (9).
To our knowledge, these are the first cases of FHHNC reported in Egyptian families and diagnosed at a molecular level; moreover this is a novel Arg55fs that showed missense mutation (C.233 G>C) causing a new amino acid (Arg55Ser, or alternatively R55S). Also in this report, case 1201 is the first in literatures found to have genito-urinary anomalies; whether a mere coincidence or as a phenoytypic expression of the different alleleic variants of PCLN-1 gene or its related proteins, it is still unknown but further studies should be contemplated. Recently on experimental level, an interaction between CLDN16 and CLDN19 has been proven and this constitutes a cation-selective tight junction complex; disruption of this interaction by mutation of either CLDN16 or CLDN19 may affect their synergistic effect and could suggest a mechanism for the role of mutant forms of CLDN16 and CLDN19 in development of FHHNC (19). So, DNA analysis of CLDN19 is highly recommended in case 1201 to differentiate whether these new genitor-urinary anomalies are expression of mutant forms' interaction or just a mere coincidence.

We can conclude that despite the rarity and the intriguing nature of FHHNC disease still it deserves consideration in any patient presented with nephrocalcinosis, hypercalciuria even before the development of renal failure especially in pediatric age group.

References:
1. Weber, S, Hoffmann, K, Jeck, N, et al. Familial hypomagnesaemia with hypercalciuria and nephrocalcinosis maps to chromosome 3q27 and is associated with mutations in the PCLN-1 gene. Eur J Hum Genet 2000; 8: 414–422.

2. Blanchard, A, Jeunemaitre, X, Coudol, P, et al. Paracellin-1 is critical for magnesium and calcium reabsorption in the human thick ascending limb of Henle. Kidney Int 2001; 59: 2206–2215.

3. Prabahar MR, Manorajan R, Fernando ME, Venkatraman R, Balaraman V, Jayakumar M. Nephrocalcinosis in siblings--familial hypomagnesemia, hypercalciuria with nephrocalcinosis (FHHNC syndrome). J Assoc Physicians India 2006; 54: 497-500.

4. Weber S, Schneider L, Peters M, et al.: Novel paracellin-1 mutations in 25 families with familial hypomagnesemia with hypercalciuria and nephrocalcinosis. J Am Soc Nephrol 2001; 12: 1872–1881.

5. Michelis MF, Drash AL, Linarelli LG, De Rubertis FR, Davis BB. Decreased bicarbonate threshold and renal magnesium wasting in a sibship with distal renal tubular acidosis: Evaluation of the pathophysiological role of parathyroid hormone. Metabolism 1972; 21: 905–920.

6. Manz F, Schärer K, Janka P, Lombeck J. Renal magnesium wasting, incomplete tubular acidosis, hypercalciuria and nephrocalcinosis in siblings. Eur J Pediatr 1978; 128: 67–79.

7. Rodriguez-Soriano J, Vallo A. Pathophysiology of the renal acidification defect present in the syndrome of familial hypomagnesaemia-hypercalciuria. Pediatr Nephrol 1994; 8: 431–435.

8. Praga M, Vara J, González-Parra E, et al. Familial hypomagnesemia with hypercalciuria and nephrocalcinosis. Kidney Int 1995; 47: 1419–1425.

9. Benigno V, Canonica CS, Bettinelli A, von Vigier RO, Truttmann AC, Bianchetti MG. Hypomagnesaemia-hypercalciuria-nephrocalcinosis: a report of nine cases and a review. Nephrol Dial Transplant 2000; 15: 605–610.

10. Simon, DB, Lu, Y, Choate, KA, et al. Paracellin-1, a renal tight junction protein required for paracellular Mg2þ resorption. Science 1999; 285: 103–106.

11. Weber, S, Schlingmann, KP, Peters, M, et al. Primary gene structure and expression studies of rodent paracellin-1. J Am Soc Nephrol 2001; 12: 2664–2672.

12. Tajima T, Nakae J, Fujieda K. Two heterozygous mutations of CLDN16 in a Japanese patient with FHHNC. Pediatr Nephrol. 2003; 18: 1280-1282.

13. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic Local Alignment Search Tool. J Mol Biol 1990; 215:403–410.

14. den Dunnen, JT, Antonarakis, SE. Mutation nomenclature extensions and suggestions to describe complex mutations: a discussion. Hum Mutat 2000; 15: 7–12.

15. Lodha R, Hari P, Bagga A. Syndrome of renal magnesium wasting and nephrocalcinosis. Indian Pediatr 1999; 36: 1046-1048.

16. Kuwertz-Bröking E, Fründ S, Bulla M, Kleta R, August C, Kisters K. Familial hypomagnesemia, hypercalciuria in 2 siblings. Clin Nephrol 2001; 56: 155-161.

17. Wolf MT, Dötsch J, Konrad M, Böswald M, Rascher W. Follow-up of five patients with FHHNC due to mutations in the Paracellin-1 gene. Pediatr Nephrol 2002; 17: 602–608.

18. Kari JA, Farouq M, Alshaya HO. Familial hypomagnesemia with hypercalciuria and nephrocalcinosis. Pediatr Nephrol 2003; 18: 506–510.

19. Hou J, Renigunta A, Konrad M, et al. Claudin-16 and claudin-19 interact and form a cation-selective tight junction complex. J Clin Invest. 2008;118: 619-628.

Wednesday, November 11, 2009

دعاء للوالد

اللهم يا ذا الجلال و الإكرام يا حي يا قيوم ندعوك باسمك الأعظم الذي إذا دعيت به أجبت!!!،
أن تبسط على والدي من بركاتك ورحمتك ورزقك
اللهم ألبسه العافية حتى يهنأ بالمعيشة، واختم له بالمغفرة حتى لا تضره الذنوب،
اللهم اكفه كل هول دون الجنة حتى يُبَلِّغْه إياها.. برحمتك يا ارحم الراحمين
اللهم لا تجعل له ذنبا إلا غفرته، ولا هما إلا فرجته، ولا حاجة من حوائج الدنيا هي لك رضا وله فيها صلاح إلا قضيتها، اللهم ولا تجعل له حاجة عند أحد غيرك،اللهم و أقر عينه بما تتمناه لنا في الدنيا، اللهم
إجعل أوقاته بذكرك معمورة، اللهم أسعده بتقواك، اللهم اجعله في ضمانك وأمانك وإحسانك
اللهم ارزقه عيشا قارا، ورزقا دارا، وعملا بارا،
اللهم ارزقه الجنة وما يقربه إليها من قول اوعمل، وباعد بينه وبين النار وبين ما يقربه إليها من قول أو عمل
اللهم اجعله من الذاكرين لك، الشاكرين لك، الطائعين لك، المنيبين لك،
اللهم واجعل أوسع رزقه عند كبر سنه، اللهم واغفر له جميع ما مضى من ذنوبه، واعصمه فيما بقي من عمره، وارزقه عملا زاكيا ترضى به عنه، اللهم تقبل توبته، وأجب دعوته
اللهم إنا نعوذ بك أن ترده إلى أرذل العمر، اللهم واختم بالحسنات أعماله.... اللهم آمين
اللهم وأعنا على بره حتى يرضى عنا فترضى، اللهم اعنا على الإحسان إليه في كبره
اللهم ورضه علينا، اللهم ولا تتوفاه إلا وهو راضي عنا تمام الرضى، اللهم واعنا على خدمته كما ينبغي له علينا، اللهم اجعلنا بارين طائعين له،
اللهم ارزقنا رضاه ونعوذ بك من عقوقه، اللهم ارزقنا رضاه ونعوذ بك من عقوقه، اللهم ارزقنا رضاه ونعوذ بك من عقوقه، اللهم آمين، اللهم آمين، اللهم آمين، وصلى الله على نبينا محمد وعلى آله و صحبه ومن تبعهم بإحسان إلى يوم الدين..

Saturday, October 3, 2009

يصلي ولا يصلي

يأتي زمان على أمتي يصلون وهم لا يصلون، قال تعالى (وذكر فإن الذكرى تنفع المؤمنين).
قال رسول الله ص: (جعلت قرة عيني في الصلاة).. بالله عليك هل صليت مرة ركعتين فكانتا قرة عينك؟ وهل اشتق مرة أن تعود سريعا إلى البيت كي تصلي ركعتين لله؟؟؟ هل اشتقت إلى الليل كي تخلو فيه مع الله؟ وانظر إلى الرسول ... كانت عائشة رضي الله عنها تجده طول الليل يصلي.. وطول النهار يدعو إلى الله تعالى فتسأله: يا رسول الله أنت لا تنام؟؟ فيقول لها (مضى زمن النوم). ويقول الصحابة : كنا نسمع لجوف النبي وهو يصلي أزيز كأزيز المرجل من البكاء؟.
روي أن سيدنا طلحة الأنصاري رضي الله عنه كان يصلي في بستانه ذات يوم ورأى طيرا يخرج من بين الشجر فتعلقت عيناه بالطائر حتى نسي كم صلى فذهب إلى الطبيب (الرسول ص) يبكي ويقول: يا رسول الله , إني انشغلت بالطائر في البستان حتى نسيت كم صليت فإني أجعل هذا البستان صدقة في سبيل الله .. فضعه يا رسول الله حيث شئت لعل الله يغفر لي.
وهذا أبو هريرة رضي الله عنه يقول: إن الرجل ليصلي ستين سنة ولا تقبل منه صلاة فقيل له : كيف ذلك؟ فقال: لا يتم ركوعها ولا سجودها ولا قيامها ولا خشوعها.
ويقول سيدنا عمر بن الخطاب رضي الله عنه: إن الرجل ليشيب في الاسلام ولم يكمل لله ركعة واحدة !! قيل : كيف يا أمير المؤمنين قال : لا يتم ركوعها ولا سجودها.
ويقول الإمام أحمد بن حنبل رحمه الله: يأتي على الناس زمان يصلون وهم لا يصلون وإني لأتخوف أن يكون الزمان هو هذا الزمان! فماذا لو أتيت إلينا يا إمام لتنظر أحوالنا؟
ويقول الإمام الغزالي رحمه الله: إن الرجل ليسجد السجدة يظن أنه تقرب بها إلى الله سبحانه وتعالى ووالله لو وزع ذنب هذه السجدة على أهل بلدته لهلكوا سئل كيف ذلك ؟؟؟ فقال : يسجد برأسه بين يدي مولاه وهو منشغل باللهو والمعاصي والشهوات وحب الدنيا .. فأي سجدة هذه؟
وقالوا.. لو رأيت سفيان الثوري يصلي لقلت : يموت الآن ( من كثرة خشوعه )؟
وهذا عروة بن الزبير ابن السيدة أسماء أخت السيدة عائشة رضي الله عنهم... أصاب رجله داء الأكلة (السرطان) فقيل له : لا بد من قطع قدمك حتى لا ينتشر المرض في جسمك كله , ولهذا لا بد أن تشرب بعض الخمر حتى يغيب وعيك .. فقال : أيغيب قلبي ولساني عن ذكر الله ؟؟ والله لا أستعين بمعصية الله على طاعته فقالوا : نسقيك المنقد (مخدرة) فقال : لا أحب أن يسلب جزء من أعضائي وأنا نائم فقالوا : نأتي بالرجال تمسكك فقال : أنا أعينكم على نفسي قالوا : لا تطيق قال : دعوني أصلي فإذا وجدتموني لا أتحرك وقد سكنت جوارحي واستقرت فأنظروني حتى أسجد فإذا سجدت فما عدت في الدنيا , فافعلوا بي ما تشاؤون !!! فجاء الطبيب وانتظر, فلما سجد أتى بالمنشار فقطع قدم الرجل ولم يصرخ بل كان يقول.. لا إله إلا الله... رضيت بالله ربا وبالإسلام دينا وبمحمد نبيا ورسولا ... حتى أغشي عليه ولم يصرخ صرخه فلما أفاق أتوه بقدمه فنظر إليها وقال : أقسم بالله إني لم أمش بك إلى حرام ويعلم الله, كم وقفت عليك بالليل قائماً لله.... فقال له أحد الصحابة : يا عروة.. أبشر.. جزء من جسدك سبقك إلى الجنة. فقال: والله ما عزاني أحد بأفضل من هذا العزاء
وكان الحسن بن علي رضي الله عنهما إذا دخل في الصلاة ارتعش واصفر لونه .. فإذا سئل عن ذلك قال: أتدرون بين يدي من أقوم الآن؟! وكان أبوه سيدنا علي رضي الله عنه إذا توضأ ارتجف فإذا سئل عن ذلك قال: الآن أحمل الأمانة التي عرضت على السماء والأرض والجبال فأبين أن يحملها وأشفقن منها... وحملتها أنا.
وسئل حاتم الأصم رحمه الله كيف تخشع في صلاتك ؟؟؟ قال : بأن أقوم فأكبر للصلاة .. وأتخيل الكعبة أمام عيني.. والصراط تحت قدمي.. والجنة عن يميني والنار عن شمالي.. وملك الموت ورائي.. وأن رسول الله يتأمل صلاتي وأظنها آخر صلاة فأكبر الله بتعظيم وأقرأ وأتدبر وأركع بخضوع وأسجد بخضوع وأجعل في صلاتي الخوف من الله والرجا في رحمته ثم أسلم ولا أدري أقبلت أم لا؟
يقول سبحانه وتعالى: (ألم يأن للذين آمنوا أن تخشع قلوبهم لذكر الله) يقول ابن مسعود رضي الله عنه: لم يكن بين إسلامنا وبين نزول هذه الآية إلا أربع سنوات.. فعاتبنا الله تعالى فبكينا لقلة خشوعنا لمعاتبة الله لنا... فكنا نخرج ونعاتب بعضنا بعضا نقول: ألم تسمع قول الله تعالى: ألم يأن للذين آمنوا أن تخشع قلوبهم لذكر الله... فيسقط الرجل منا يبكي على عتاب الله لنا
هل شعرت أنت يا أخي أن الله تعالى يعاتبك بهذه الآية؟ منقـــــول للفائـــدة

Friday, October 2, 2009

مبطلات الأعمال الصالحة

- وَقَدِمْنَا إِلَى مَا عَمِلُوا مِنْ عَمَلٍ فَجَعَلْنَاهُ هَبَاءً مَنْثُورًا (23) الفرقان.
- وَلَا تَكُونُوا كَالَّتِي نَقَضَتْ غَزْلَهَا مِنْ بَعْدِ قُوَّةٍ أَنْكَاثًا تَتَّخِذُونَ أَيْمَانَكُمْ دَخَلًا بَيْنَكُمْ أَنْ تَكُونَ أُمَّةٌ هِيَ أَرْبَى مِنْ أُمَّةٍ إِنَّمَا يَبْلُوكُمُ اللَّهُ بِهِ وَلَيُبَيِّنَنَّ لَكُمْ يَوْمَ الْقِيَامَةِ مَا كُنْتُمْ فِيهِ تَخْتَلِفُونَ (92) النحل.

نعوذ بالله أن نكون منهم – آمين.. وفيما يلي أهم أسباب إحباط ومبطلات الأعمال الصالحة

1. الرياء وعدم تجديد النية لمرضاة الله تعالى. يَا أَيُّهَا الَّذِينَ آَمَنُوا لَا تُبْطِلُوا صَدَقَاتِكُمْ بِالْمَنِّ وَالْأَذَى كَالَّذِي يُنْفِقُ مَالَهُ رِئَاءَ النَّاسِ وَلَا يُؤْمِنُ بِاللَّهِ وَالْيَوْمِ الْآَخِرِ فَمَثَلُهُ كَمَثَلِ صَفْوَانٍ عَلَيْهِ تُرَابٌ فَأَصَابَهُ وَابِلٌ فَتَرَكَهُ صَلْدًا لَا يَقْدِرُونَ عَلَى شَيْءٍ مِمَّا كَسَبُوا وَاللَّهُ لَا يَهْدِي الْقَوْمَ الْكَافِرِينَ (264) البقرة – إنما الأعمال بالنيات (الحديث). فالحل هو تجديد النية لله تعالى وحمل هم القبول أقرب إلى القبول، وأهم شرط للقبول هو التقوى (قبول هدي أحد إبني آدم – قبول إمرأة عمران – قبول رفع القواعد من إبراهيم وإسماعيل). وَالَّذِينَ يُؤْتُونَ مَا آَتَوْا وَقُلُوبُهُمْ وَجِلَةٌ أَنَّهُمْ إِلَى رَبِّهِمْ رَاجِعُونَ (60) المؤمنون – (عن عائشة أنها قالت: يا رسول الله الذين يؤتون ما آتوا وقلوبهم وجلة هو الذي يسرق ويزني ويشرب الخمر وهو يخاف الله عز وجل ؟ قال: «لا يا بنت الصديق، ولكنه الذي يصلي ويصوم ويتصدق وهو يخاف الله عز وجل» - تفسير ابن كثير.
2. الإجتراء على الله في الخلوات. سواء بمشاهدة ما حرم الله على التلفاز أو النت (لا تجعل الله أهون الناظرين إليك). علاجها بالإنكسار لله تعالى فهو أقرب الطرق - كما ذكر ابن القيم – للوصول إلى معية الله – طريق لا يزاحمك فيه أحد.
3. رفع الصوت على النبي: بالتعدي على محارم الله: عندما نسمع قال الله وقال الرسول.. نقول سمعنا وأطعنا.. مَا أَفَاءَ اللَّهُ عَلَى رَسُولِهِ مِنْ أَهْلِ الْقُرَى فَلِلَّهِ وَلِلرَّسُولِ وَلِذِي الْقُرْبَى وَالْيَتَامَى وَالْمَسَاكِينِ وَابْنِ السَّبِيلِ كَيْ لَا يَكُونَ دُولَةً بَيْنَ الْأَغْنِيَاءِ مِنْكُمْ وَمَا آَتَاكُمُ الرَّسُولُ فَخُذُوهُ وَمَا نَهَاكُمْ عَنْهُ فَانْتَهُوا وَاتَّقُوا اللَّهَ إِنَّ اللَّهَ شَدِيدُ الْعِقَابِ (7) الحشر - يَا أَيُّهَا الَّذِينَ آَمَنُوا لَا تُقَدِّمُوا بَيْنَ يَدَيِ اللَّهِ وَرَسُولِهِ وَاتَّقُوا اللَّهَ إِنَّ اللَّهَ سَمِيعٌ عَلِيمٌ (1) يَا أَيُّهَا الَّذِينَ آَمَنُوا لَا تَرْفَعُوا أَصْوَاتَكُمْ فَوْقَ صَوْتِ النَّبِيِّ وَلَا تَجْهَرُوا لَهُ بِالْقَوْلِ كَجَهْرِ بَعْضِكُمْ لِبَعْضٍ أَنْ تَحْبَطَ أَعْمَالُكُمْ وَأَنْتُمْ لَا تَشْعُرُونَ (2) الحجرات.
4. الإستكثار من الأعمال الصالحة، سواء بذكرها للناس (الرياء) أو ذكرك لها خاليا.. فقد الله تعالي لأحسن العابدين (الرسول الكريم) وَلَا تَمْنُنْ تَسْتَكْثِرُ (6) وَلِرَبِّكَ فَاصْبِرْ (7) المدثر.
5. الظلم: حتى ولو كان المظلوم كافراً فقد أهديته حسناتك وأهدرت طاعتك.

نفعني الله وإياكم بالقرآن والسنة.. آمين

Saturday, September 6, 2008

من أقوال صفوة الصحابة والتابعين

إلــــــهي... كــفــاني فـخـــراً أن تـكـــون لي ربــــــــاً
كـل شيء يـبـدأ صـغـيراً ثـم يكـبر إلا المصيـبة ، فـإنـها تـبـدأ كــبـيرة ثـم تـصـغــر
عـجـبـتُ مـمـن يـشـتـري المـمـالـيـك بـمـالـه ، كــيـف لا يـشـــتـري الأحــــــرار بـمـعــروفــه
حـمـل الصـدق كـحـمـل الجـبـال الـرواسي ، لا يـطـيـقـه إلا أصـحــاب الـعـزائـــم
لـئـن أطـلـب الـدنـيـا بـمـزمــار ، أحـب إلي مــن أن أطـلـبـهـــا بـالـديـــن
خِـــف الله عـلى قـــدر قــدرتـــه عـليــك ، واسـتـحي مـنـه عـلى قـدر قــربـه مـنـك
لا دار للمـرء بعد الموت يسكنها ، إلا التي كان قبل الموت يـبنيها
فإن بناها بخيرٍ طاب مسكنها ، وإن بناها بـشـرٍ خاب بانيها
إتــّقِ الله أن يكون الله أهون النـاظريـن إليـك
إذا بـلغـك عن أخـيـك شـيـئـاً تـكـرهه فـالتـمس لـه العـذر ، فإن لم تجد له عذراً فقل في نفسك لعلّ لأخي عذراً لا أعلمه
من رضي بقضاء الله جرى عليه وكان له أجـر ، ومن لم يـرضَ جـرى عـلـيـه وحـبـــط عـمـلــه

الغضـب مثـل السـبـع إ،ذا أفـلتـه صاحـبه بـدأ بـأكـلـه
لـئـن يعضّ أحـدكـم على جمـرةٍ حتى تطفأ خيرٌ له من أن يقول لأمــرٍ قضــاه الله ليـت هــذا لـم يـكــن

Sunday, August 17, 2008

أمارات الساعة التي وقعت من زمن بعيد

1. بعثة الرسول صلى الله عليه وسلم ووفاته: عن سهل بن سعد قال: (رأيت رسول الله صلى الله عليه وسلم قال بإصبعيه هكذا الوسطى والتي تلي الإبهام وقال: بعثت أنا والساعة كهاتين).[1]. وعن عوف بن مالك أن النبي صلى الله عليه وسلم قال له: (اعدد بين يدي الساعة: موتي).[2].
2. انشقاق القمر: عن أنس أن أهل مكة سألوا رسول الله صلى الله عليه وسلم أن يريهم آية فأراهم انشقاق القمر مرتين.[3]. وعن ابن مسعود رضي الله عنه: (بينما نحن مع رسول الله صلى الله عليه وسلم بمنى إذ انفلق القمر فلقتين فكانت فلقة وراء الجبل وفلقة دونه فقال لنا رسول الله صلى الله عليه وسلم: {اشهدوا}).[4] وقد ذكره الله تعالى في كتابه: (اقتربت الساعة وانشق القمر)، واتفق العلماء على أن القمر انشق على عهد رسول الله صلى الله عليه وسلم.
3. نار الحجاز التي أضاءت أعناق الإبل ببصرى: عن أبي هريرة رضي الله عنه أن رسول الله صلى الله عليه وسلم قال: (لا تقوم الساعة حتى تخرج نار من أرض الحجاز تضيء أعناق الإبل ببصرى).[5]. بصرى: هي مدينة حوران بالشام بينها وبين دمشق ثلاث مراحل، هذه الآية التي أخبر الصادق المصدوق بوقوعها قد وقعت على الصورة التي أخبر الرسول صلى الله عليه وسلم وقد كان خروجها سنة 654 للهجرة النبوية. ومن الذين ذكروا أحداثها بالتفصيل العلامة ابن كثير طيب الله ثراه، في أحداث سنة 654 هـ في كتابه: (البداية والنهاية) وقد عاصرها العلامة الحافظ شهاب الدين أبو شامة المقدسي والإمام النووي شارح مسلم الذي يقول: (وقد خرجت في زماننا بالمدينة سنة أربع وخمسين وستمائة وكانت ناراً عظيمة جداً من جنب المدين الشرقي وراء الحرة تواتر العلم بخروجها عند جميع الشام وسائر البلدان وأخبرني من حضرها من أهل المدينة[6]. وواضح من وصف المشاهدين لهذه النار أنها كانت بركاناً هائلاً، وقال أحد العلماء: سمعت رجلاً من الأعراب يخبر والدي ببصرى تلك الليلة أنهم رأوا أعناق الإبل في ضوء هذه النار التي ظهرت في أرض الحجاز وكان مما ذكره آخرون أنه كتب بـ (تيماء) على ضوءها الكتب، قال: وكنا في بيوتنا تلك الليلة وكأن في دار كل واحد منا سراج، ولم يكن لها حَرٌ ولَفْح على عظمها وإنما كانت آية من آيات الله عز وجل).
4. توقف الجزية والخراج: الجزية: هي التي يدفعها أهل الذمة في الدولة الإسلامية، الخراج: الذي يدفعه من يستغل الأراضي التي فتحت في الدولة الإسلامية. سبب توقفها: استيلاء الكفار على تلك الديار في بعض الأزمنة، ففي صحيح مسلم عن أبي هريرة قال: قال رسول الله صلى الله عليه وسلم: (منعت العراق درهما وقفيزها، ومنعت الشام مدها ودينارها، ومنعت مصر إردبها ودينارها، وعُدتم من حيث بدأتم، وعُدتم من حيث بدأتم، شهد على ذلك لحم أبي هريرة ودمه). والقفيز، والمد، والإردب: مكاييل لأهل ذلك الزمان في تلك البلاد وبعضها ما يزال معروفاً الى أيامنا.
المراجع:
1. متفق عليه.
2. رواه البخاري.
3. رواه مسلم.
4. رواه مسلم.
5. رواه البخاري.
6. شرح مسلم 18/28.

ماذا تحب من الدنيا

جلس رسول الله صلى الله عليه وسلم مع أصحابه رضي الله عنهم وسألهم،
مبتدأ بأبي بكر: ماذا تحب من الدنيا ؟ فقال أبو بكر ( رضي الله عنه) أحب من الدنيا ثلاث الجلوس بين يديك، والنظر اليك، وأنفاق مالي عليك..
وأنت يا عمر ؟ قال أحب ثلاث: أمر بالمعروف ولو كان سرا، ونهي عن المنكر ولو كان جهرا، وقول الحق ولو كان مرا..
وأنت يا عثمان؟ قال أحب ثلاث: إطعام الطعام، وإفشاء السلام، والصلاة باليل والناس نيام..
وأنت يا علي؟ قال أحب ثلاث: إكرام الضيف، الصوم بالصيف، وضرب العدو بالسيف..
ثم سأل أبا ذر الغفاري: وأنت يا أبا ذر: ماذا تحب في الدنيا؟ قال أبو ذر:أحب في الدنيا ثلاث: الجوع؛ المرض؛ والموت فقال له النبي (صلى الله عليه وسلم): ولم؟ فقال أبو ذر: أحب الجوع ليرق قلبي؛ وأحب المرض ليخف ذنبي؛ وأحب الموت لألقى ربي..
فقال النبي (صلى الله عليه وسلم) حبب إلى من دنياكم ثلاث الطيب؛ والنساء؛ وجعلت قرة عيني في الصلاة.
وحينئذ تنزل جبريل عليه السلام وأقرأهم السلام وقال: وانأ أحب من دنياكم ثلاث تبليغ الرسالة؛ وأداء الأمانة؛ وحب المساكين؛ ثم صعد إلى السماء وتنزل مرة أخرى؛
وقال: الله عز وجل يقرؤكم السلام ويقول: أنه يحب من دنياكم ثلاث لسانا ذاكرا؛ وقلبا خاشعا؛ وجسدا على البلاء صابرا..
منقول للأمانة.