Original Article
Familial Hypomagnesemia with Hypercalciuria and Nephrocalcinosis: Unusual Clinical Associations and Novel Claudin16 Mutation in an Egyptian family
Mohammad Al-Haggar a, Ashraf Bakr b, Toshihiro Tajima c, Kenji Fujieda d, Ayman Hammad b, Othman Soliman a, Ahmad Darwish b, Afaf Al-Said a, Sohier Yahia a, Dina Abdel-Hady a
a Genetics Unit, Mansoura University Children's Hospital, Mansoura, Egypt
b Nephrology Unit, Mansoura University Children's Hospital, Mansoura, Egypt
c Department of Pediatrics, Hokkaido University School of Medicine, Japan
d Department of Pediatrics, Asahikawa Medical College, Japan
Correspondence: Mohammad Al-Haggar, MD., Genetics Unit, Mansoura University Children's Hospital, Mansoura, Egypt
Phone: +2050 2211948, +20502310661, +20111715350, Fax: +20502234092
Email: m.alhaggar@yahoo.co.uk
Abstract.
Background: Familial hypomagnesemia with hypercalciuria and nephrocalcinosis (FHHNC) is a rare autosomal recessive tubular disorder that eventually progresses to renal failure depending upon extent of nephrocalcinosis. Its basic pathogenesis is impaired tubular resorption of magnesium and calcium in thick ascending limb of loop of Henle (TAL) which is due to a genetic defect in paracellin-1 (a tight junction protein expressed in TAL). Mutations of Claudin16 gene (CLDN16), formerly called paracellin-1 gene (PCLN-1), have been linked to FHHNC.
Methods: An extended Egyptian family with more than one member affection by nephrocalcionsis was included and thoroughly investigated in the current study after taking an informed consent. Thorough history taking for polyuria, polydipsia and hypocalcemia symptoms, as well as clinical examination with stress on anthropometric measurements and radiological evaluation for kidneys and bones. Laboratory work up for differential diagnosis of nephrocalcinosis was done: complete urinalysis including urinary calcium excretion, urine pH and electrolytes, arterial blood gas (ABG), serum electrolytes (sodium, potassium, calcium, magnesium and phosphorous), renal function tests as well as parathyroid and gonadotropin-sex hormone assay. DNA extraction from peripheral blood leukocytes was done followed by amplification using primers previously described, purification and finally sequencing to analyze each exon of the CLDN16 gene.
Results: Two sibs for a consanguineous couple were affected by nephrocalcinosis and showed persistent hypocalcemia, hypercalciuria, nephrocalcinosis with persistently alkaline urine, and ocular manifestations in the form of congenital cataract, high myopia and retinal abnormalities. The elder sib showed genitourinary abnormalities in the form of hypospadias and cryptorchidism. These two sibs had homozygous two bases deletion in exon 1 of CLDN16 gene (C. 233_234 del GG; Ins C) causing a frame shift mutation (Arg55fs), however their parents were heterozygote carriers for that mutation.
Conclusion: The above mentioned clinical data in the two affected sibs together with family history of end stage renal disease associated with nephrocalcinosis and high myopia suggest diagnosis of FHHNC which had been confirmed, for the first time in an Egyptian family, by a novel mutation in exon 1 of CLDN16 gene. Genitourinary associations with FHHNC had not been reported in literatures yet. Currently, we will try to highlight the principles of mutations detection based on sequencing with the use of the online NCBI databases, statistics and other search tools.
Keywords: Familial hypomagnesemia with hypercalciuria and nephrocalcinosis, Paracellin-1, CLDN16.
Introduction:
Nephrocalcinosis which means a generalized increase in the renal calcium content is usually incidentally detected and is not uncommon in the hospital practice. Depending upon its location it could be cortical which is rare, however the medullary form constitutes 98% of cases of nephrocalcinosis. The most common causes of nephrocalcinosis are hyperparathyroidism, distal tubular acidosis, idiopathic hypercalciuria and hyperoxaluria. Familial hypomagnesemia with hypercalciuria and nephrocalcinosis (FHHNC - OMIM 248250) is a rare autosomal recessive disorder characterized by hypomagnesemia, hypercalciuria and nephrocalcinosis which can result in end stage renal disease (ESRD) with the need for renal replacement therapy in about 50% of cases; usually in the second decade of life (1-3). The only known cure is renal transplantation, however symptomatic treatment in the form of magnesium citrate and calcium replacements, or the use hydrochlorothiazide only delays the onset of ESRD (4).
FHHNC was first described in 1972 (5), its frequent initial symptoms include recurrent urinary tract infections, polyuria and polydipsia, in addition to marked hypomagnesemia; all cases exhibit hypercalciuria and nephrocalcinosis. Additional symptoms include nephrolithiasis, abdominal pain, convulsions, muscular twitches, failure to thrive, incomplete distal renal tubular acidosis and hypocitraturia (6-8). Some authors reported elevated serum parathyroid hormone (PTH) levels early in the course of the disease, independently of glomerular filtration rate (GFR) (8). Ocular abnormalities and hearing impairment have been reported as inconsistent extra-renal findings (9).
Mutations in the Claudin-16 gene (CLDN16, previously called paracellin-1; PCLN-1 gene), have been linked to FHHNC; it encodes a tight junction protein (Paracellin-1), member of Claudin family, which is expressed in the tight junctions of thick ascending limb (TAL) of loop of Henle. It has 4 transmembrane domains and 2 extracellular loops. It is speculated that PCLN-1 might be a paracellular ion channel or might be involved in regulating paracellular ion conductance. Unlike in the distal convoluted tubule where the bulk of calcium absorption is across the epithelial cell, cation transport in TAL is largely paracellular driven by lumen positive electric potential. To date 24 different PCLN-1 mutations were identified (4); most of these mutations (67%) were missense although deletions and frame shift mutations were also reported. Most mutations occur in the transmembrane and extracellular domains; the first extracellular loop of PCLN-1 was the region most often affected by single nucleotide exchange. Thus it is plausible that these mutations interfere with the function of the paracellular barrier and lead to abnormalities of transport in TAL, a major site for calcium and magnesium reabsorption (4, 10, 11).
In the current study we reported the clinical course of two affected sibs who were product of a consanguineous Egyptian couple; they were accidentally discovered by ultrasonographic findings of nephroclcinosis; analysis of CLDN16 (PCLN-1) gene revealed that the 2 sibs were homozygous for two bases deletion in exon 1 (C. 232_235 delGGinsC) causing a frame shift mutation (Arg55fs), their parents were carriers for the same mutation.
Patients and Methods:
An extended multi-generation Egyptian family with more than one member affection by nephrocalcionsis was included and thoroughly investigated in the current study after taking an informed consent from patients or their guardians. This family was referred to our hospital; Mansoura University Children's Hospital (MUCH) at December 2007, due to the presentation of probands (1201 and 1202); polyuria, polydipsia, vomiting, failure to thrive and tetanic seizures. Both sibs were born of full term normal delivery. Probands as well as all members were subjected to thorough history taking and clinical examination with stress on anthropometric measurements and radiological work up for kidneys and bones. Laboratory work up for consideration of the different causes of nephrocalcinosis had been done: complete urinalysis including urinary calcium, urine pH and electrolytes, arterial blood gas (ABG), serum electrolytes (sodium, potassium, calcium, magnesium and phosphorous), renal function tests and parathyroid hormone level. The older sib showed some genito-urinary abnormalities (hypospadias and crypotorchidism) for which he underwent hormonal assay of the goandotropin-sex steroid axis (testosterone, dihydrotestesterone, follicle stimulating hormone; FSH, and lutenizing hormone; LH).
DNA extraction from peripheral blood leukocyte samples was done using the DNA purification Capture Column Kit (Gentra kit). DNA amplification and sequence analysis had been performed. Each exon of the CLDN16 gene was amplified by polymerase chain reaction (PCR) using primers previously described (1, 12). The PCR conditions consisted of 9 min at 94oC followed by 30 cycles of 30 s at 94oC, 30 s at 52oC, and 30 s at 72oC in a Perkin-Elmer Gene Amp PCR System 2400 thermal cycler (PE Applied Biosystems, Foster City, Calif., USA). After amplification, the PCR products were purified from low-melting agarose gel, and the purified products were sequenced directly with an ABI PRISM Dye Terminator Cycle Sequencing Kit and an ABI 373A automated fluorescent sequencer (PE Applied Biosystems).
Results:
The two sibs (1201, 1202) were born for a consanguineous Egyptian couple (second cousins), they had no history of urinary problems, clinical evidence of skeletal or dental abnormalities, abdominal ultrasonography demonstrated bilateral nephrocalcinosis in both sibs (Fig. 1). Eye signs included high myopia and retinal abnormalities (hyperpigmentation and whitish patches) with bilateral congenital cataract in the older sib (1201) for which he underwent surgery. Sib 1201 who had previous surgery for hypospadias and cryptorchidism showed within normal range hormonal profile that assessed the gonadotropin-sex steroid axis (testosterone, dihydrotestesterone, FSH, LH). Multigeneration pedigree is shown in (Fig. 2) demonstrating the consanguineous relationship and route of carriage form grandparents. The two probands (1201, 1202) as well as their consanguineous parents (1101, 1102) were thoroughly evaluated biochemically and molecularly, however there were other four affected members, product of a non-consanguineous couple, they were proved to have nephrocalcinosis, but no blood sample was available for further biochemical and DNA analysis.
Both sibs (1201, 1202) had persistent hypocalcemia, hypercalciuria, alkaline urine, hypomagnesemia, with no evidence of other urinary losses (glycosuria or aminoaciduria) but with secondary hyperparathyroidism. Renal function was normal in both sibs at time of diagnosis (serum creatinine 0.6 and 0.5 mg/dL respectively, glomerular filteration rate (GFR) according to Schwartz formula was 110-115 mL/min/1.73 M2). Summary of clinical and biochemical profile is shown in (Table 1). Hypokalemia found in case 1202 could be explained by the nephrogenic diabetes insipidus, however the use of thiazides in combination with salt restriction for treatment of polyuria in such situation may be the possible factors explaining hyponatremia found in both cases (1201, 1202). PTH level was higher in both sibs than normal; being eight folds higher in 1202 compared to 1201; this disparity could be attributed to the early start of treatment in the older sib (1201).
Skeletal survey, ear, nose and throat evaluation were unremarkable. Parents (1101, 1102) showed uneventful urine analysis, blood biochemistry, serum magnesium and imaging studies.
With the aforementioned data, diagnosis of FHHNC had been entertained and genetic testing for CLDN16 muataion was confirmatory (see below). Both sibs were treated with sodium bicarbonate, thiazide diuretic, calcitriol and calcium carbonate; they are still on regular outpatient follow up in MUCH, Egypt.
Mutation analysis of CLDN16:
Tabulation of the codant part of exon-1 (from its initiator codon at bp 69 to its end at bp 392), showed that this exon is normally translated to 108 amino acids [http://www.genatlas]. We used the online statistical engine; BLAST (Basic Local Alignment Search Tool) provided by NCBI (National Center for Biotechnical Information) for aligning purposes (13). About 40-44 bases flanking the sequenced query segment (Fig. 3, 4) were entered and compared with their reference sequence in human genome.
BLAST summary result: [http://blast.ncbi.nlm.nih.gov/Blast/]
The affected Siblings (1201, 1202):claudin 16Score= 56.0 bits (28), Expect= 1e-06, Identities= 38/40 (95%), Gaps= 1/40 =2% Query sequence AGTGGGGCCAGC-CTGGTGTCTGCCCATGTTGCCATCCT Subject 96601212 AGTGGGGCCAGGGCTGGTGTCTGCCCATGTTGCCATCCT 96601251 Comment:Codon 55 AGG (Arginine) à AGC (Serine); missense mutation.Codon 56 GCT (Alanine) à -CT i.e. del G; causing changes of the whole reading frame i.e. (Frame shift mutation).
We can conclude that in these patients, codons 55 & 56 (AGG GCT) were changed into (AGC -CT); therefore the nomenclature of this mutation according to recommendations of den Dunnen and Antonarakis (14), will be as follow:
1. At the DNA level:- There is combined insertion/deletions (indels) named as C.232_235 delGGinsC; denotes deletion of nucleotides GG (233, 234) and insertion C.
2. At the protein level:- Arg55fs (Frame shift mutation starting just after codon 55 that codes for arginine (due to C.234 del G; deletion of the first nucleotide G in codon 56) causing change of the whole reading frame (Fig. 3). This frameshift mutation has been indexed in [http://www.ncbi.nlm.nih.gov/RefSeq] as follow:
Contig pos
mRNA orientation
mRNA pos
Function
Nucleotide pos
Amino acid pos
96601224
Forward
234
Frame shift
1
56
Moreover, Weber et al (2000) have documented this frameshift mutation (Arg55fs); they reported two consanguineous but unrelated families (family 4 and 8) of different ethnic origin demonstrating a homozygous frame shift mutation that affected the N-terminal part of PCLN-1 causing a nonsense amino acid sequence from amino acid position 55 to 89 (1). The unique feature found in mutation described in this current report is the coexistence of missense mutation in codon 55 just before the frame shift mutation (Arg 55 Ser), therefore, nomenclature of our complex mutation will be Arg/Ser55fs.
Mutation analysis of both parents at that site [C. 232_235] which is assigned by arrows (Fig. 4); showed double bands; one coincident with the reference sequence entered manually and the other was identical to the mutant allele found in affected sibs, so parents were considered to be heterozygote carriers for that mutation. The four affected sibs of the non-consanguineous couple, although not analyzed molecularly, could be explained by the founder effect as the family is routed from a small community with high inbreeding.
Discussion:
FHHNC is an autosomal recessive disorder firstly described 1972 (5); its cardinal features include renal wasting of magnesium and calcium associated with the development of nephrocalcinosis and/or renal stones in early childhood. In any patient with renal calcium leak, there will be secondary hyperparathyroidism, so serum PTH level is expectedly high in FHHNC patients. The usual presenting features of this disorder are polyuria, excessive thirst, tetanic seizures, muscle cramps and muscle weakness due to magnesium deficiency. Additional manifestations include failure to thrive, recurrent urinary tract infections, growth retardation, rickets, renal stones, abdominal colic and incomplete distal tubular acidosis (9). Increased urinary calcium excretion, magnesium deficiency and urinary acidification defects account for the tendency towards nephrocalcinosis and nephrolithiasis in FHHNC (15).
A spectrum of extra-renal associations had been reported with FHHNC; these include ocular manifestations in almost half of cases and hearing impairment in about 10% (9). Ocular involvements are usually in the form of myopia and macular colobomata, however nystagmus and tapeto-retinal degeneration were also described. Bilateral cataract reported in sib (1201) could be sequel of prolonged hypocalcemia rather than a mere association. It is currently not known whether PCLN-1 gene is also expressed in eye (4).
Parental consanguinity was noted in 6 out of 35 families; none of the parents had full blown clinical picture, however abnormal renal findings such as isolated hypercalciuria or renal stones were discovered in 16 out of 23 families (1). In the current study, although parents were proven to be heterozygote carriers of the currently described mutation, none of them showed any clinical or laboratory evidence of renal transport defect.
Most patients with FHHNC progress to ESRD; renal failure often occurs in the second or third decade of life. The severity of nephrocalcinosis is usually correlated with rapid progression to ESRD but this association was disputed in some literatures (4, 8, 16-18). Tubulopathies accompanied by nephrocalcinosis are not uniformly progressing to renal failure; for example in distal tubular acidosis and Bartter' syndrome, GFR is usually not impaired despite severe nephrocalcinosis. Therefore additional unidentified factors seem to be important for the development of renal failure in cases of FHHNC (16). In the current report, our cases (1201, 1202) still have normal renal function perhaps due to their young age; they were put on the conventional therapeutic measures; continuous administration of magnesium supplements, thiazides to reduce hypercalciuria, however serum magnesium remains lower than normal and renal calcium leak continues. Theoretically these measures have no impact on the ultimate development of renal failure and renal transplant should be the only definitive therapy (9).
To our knowledge, these are the first cases of FHHNC reported in Egyptian families and diagnosed at a molecular level; moreover this is a novel Arg55fs that showed missense mutation (C.233 G>C) causing a new amino acid (Arg55Ser, or alternatively R55S). Also in this report, case 1201 is the first in literatures found to have genito-urinary anomalies; whether a mere coincidence or as a phenoytypic expression of the different alleleic variants of PCLN-1 gene or its related proteins, it is still unknown but further studies should be contemplated. Recently on experimental level, an interaction between CLDN16 and CLDN19 has been proven and this constitutes a cation-selective tight junction complex; disruption of this interaction by mutation of either CLDN16 or CLDN19 may affect their synergistic effect and could suggest a mechanism for the role of mutant forms of CLDN16 and CLDN19 in development of FHHNC (19). So, DNA analysis of CLDN19 is highly recommended in case 1201 to differentiate whether these new genitor-urinary anomalies are expression of mutant forms' interaction or just a mere coincidence.
We can conclude that despite the rarity and the intriguing nature of FHHNC disease still it deserves consideration in any patient presented with nephrocalcinosis, hypercalciuria even before the development of renal failure especially in pediatric age group.
References:
1. Weber, S, Hoffmann, K, Jeck, N, et al. Familial hypomagnesaemia with hypercalciuria and nephrocalcinosis maps to chromosome 3q27 and is associated with mutations in the PCLN-1 gene. Eur J Hum Genet 2000; 8: 414–422.
2. Blanchard, A, Jeunemaitre, X, Coudol, P, et al. Paracellin-1 is critical for magnesium and calcium reabsorption in the human thick ascending limb of Henle. Kidney Int 2001; 59: 2206–2215.
3. Prabahar MR, Manorajan R, Fernando ME, Venkatraman R, Balaraman V, Jayakumar M. Nephrocalcinosis in siblings--familial hypomagnesemia, hypercalciuria with nephrocalcinosis (FHHNC syndrome). J Assoc Physicians India 2006; 54: 497-500.
4. Weber S, Schneider L, Peters M, et al.: Novel paracellin-1 mutations in 25 families with familial hypomagnesemia with hypercalciuria and nephrocalcinosis. J Am Soc Nephrol 2001; 12: 1872–1881.
5. Michelis MF, Drash AL, Linarelli LG, De Rubertis FR, Davis BB. Decreased bicarbonate threshold and renal magnesium wasting in a sibship with distal renal tubular acidosis: Evaluation of the pathophysiological role of parathyroid hormone. Metabolism 1972; 21: 905–920.
6. Manz F, Schärer K, Janka P, Lombeck J. Renal magnesium wasting, incomplete tubular acidosis, hypercalciuria and nephrocalcinosis in siblings. Eur J Pediatr 1978; 128: 67–79.
7. Rodriguez-Soriano J, Vallo A. Pathophysiology of the renal acidification defect present in the syndrome of familial hypomagnesaemia-hypercalciuria. Pediatr Nephrol 1994; 8: 431–435.
8. Praga M, Vara J, González-Parra E, et al. Familial hypomagnesemia with hypercalciuria and nephrocalcinosis. Kidney Int 1995; 47: 1419–1425.
9. Benigno V, Canonica CS, Bettinelli A, von Vigier RO, Truttmann AC, Bianchetti MG. Hypomagnesaemia-hypercalciuria-nephrocalcinosis: a report of nine cases and a review. Nephrol Dial Transplant 2000; 15: 605–610.
10. Simon, DB, Lu, Y, Choate, KA, et al. Paracellin-1, a renal tight junction protein required for paracellular Mg2þ resorption. Science 1999; 285: 103–106.
11. Weber, S, Schlingmann, KP, Peters, M, et al. Primary gene structure and expression studies of rodent paracellin-1. J Am Soc Nephrol 2001; 12: 2664–2672.
12. Tajima T, Nakae J, Fujieda K. Two heterozygous mutations of CLDN16 in a Japanese patient with FHHNC. Pediatr Nephrol. 2003; 18: 1280-1282.
13. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. Basic Local Alignment Search Tool. J Mol Biol 1990; 215:403–410.
14. den Dunnen, JT, Antonarakis, SE. Mutation nomenclature extensions and suggestions to describe complex mutations: a discussion. Hum Mutat 2000; 15: 7–12.
15. Lodha R, Hari P, Bagga A. Syndrome of renal magnesium wasting and nephrocalcinosis. Indian Pediatr 1999; 36: 1046-1048.
16. Kuwertz-Bröking E, Fründ S, Bulla M, Kleta R, August C, Kisters K. Familial hypomagnesemia, hypercalciuria in 2 siblings. Clin Nephrol 2001; 56: 155-161.
17. Wolf MT, Dötsch J, Konrad M, Böswald M, Rascher W. Follow-up of five patients with FHHNC due to mutations in the Paracellin-1 gene. Pediatr Nephrol 2002; 17: 602–608.
18. Kari JA, Farouq M, Alshaya HO. Familial hypomagnesemia with hypercalciuria and nephrocalcinosis. Pediatr Nephrol 2003; 18: 506–510.
19. Hou J, Renigunta A, Konrad M, et al. Claudin-16 and claudin-19 interact and form a cation-selective tight junction complex. J Clin Invest. 2008;118: 619-628.
Thursday, November 12, 2009
Wednesday, November 11, 2009
دعاء للوالد
اللهم يا ذا الجلال و الإكرام يا حي يا قيوم ندعوك باسمك الأعظم الذي إذا دعيت به أجبت!!!،
أن تبسط على والدي من بركاتك ورحمتك ورزقك
اللهم ألبسه العافية حتى يهنأ بالمعيشة، واختم له بالمغفرة حتى لا تضره الذنوب،
اللهم اكفه كل هول دون الجنة حتى يُبَلِّغْه إياها.. برحمتك يا ارحم الراحمين
اللهم لا تجعل له ذنبا إلا غفرته، ولا هما إلا فرجته، ولا حاجة من حوائج الدنيا هي لك رضا وله فيها صلاح إلا قضيتها، اللهم ولا تجعل له حاجة عند أحد غيرك،اللهم و أقر عينه بما تتمناه لنا في الدنيا، اللهم
إجعل أوقاته بذكرك معمورة، اللهم أسعده بتقواك، اللهم اجعله في ضمانك وأمانك وإحسانك
اللهم ارزقه عيشا قارا، ورزقا دارا، وعملا بارا،
اللهم ارزقه الجنة وما يقربه إليها من قول اوعمل، وباعد بينه وبين النار وبين ما يقربه إليها من قول أو عمل
اللهم اجعله من الذاكرين لك، الشاكرين لك، الطائعين لك، المنيبين لك،
اللهم واجعل أوسع رزقه عند كبر سنه، اللهم واغفر له جميع ما مضى من ذنوبه، واعصمه فيما بقي من عمره، وارزقه عملا زاكيا ترضى به عنه، اللهم تقبل توبته، وأجب دعوته
اللهم إنا نعوذ بك أن ترده إلى أرذل العمر، اللهم واختم بالحسنات أعماله.... اللهم آمين
اللهم وأعنا على بره حتى يرضى عنا فترضى، اللهم اعنا على الإحسان إليه في كبره
اللهم ورضه علينا، اللهم ولا تتوفاه إلا وهو راضي عنا تمام الرضى، اللهم واعنا على خدمته كما ينبغي له علينا، اللهم اجعلنا بارين طائعين له،
اللهم ارزقنا رضاه ونعوذ بك من عقوقه، اللهم ارزقنا رضاه ونعوذ بك من عقوقه، اللهم ارزقنا رضاه ونعوذ بك من عقوقه، اللهم آمين، اللهم آمين، اللهم آمين، وصلى الله على نبينا محمد وعلى آله و صحبه ومن تبعهم بإحسان إلى يوم الدين..
أن تبسط على والدي من بركاتك ورحمتك ورزقك
اللهم ألبسه العافية حتى يهنأ بالمعيشة، واختم له بالمغفرة حتى لا تضره الذنوب،
اللهم اكفه كل هول دون الجنة حتى يُبَلِّغْه إياها.. برحمتك يا ارحم الراحمين
اللهم لا تجعل له ذنبا إلا غفرته، ولا هما إلا فرجته، ولا حاجة من حوائج الدنيا هي لك رضا وله فيها صلاح إلا قضيتها، اللهم ولا تجعل له حاجة عند أحد غيرك،اللهم و أقر عينه بما تتمناه لنا في الدنيا، اللهم
إجعل أوقاته بذكرك معمورة، اللهم أسعده بتقواك، اللهم اجعله في ضمانك وأمانك وإحسانك
اللهم ارزقه عيشا قارا، ورزقا دارا، وعملا بارا،
اللهم ارزقه الجنة وما يقربه إليها من قول اوعمل، وباعد بينه وبين النار وبين ما يقربه إليها من قول أو عمل
اللهم اجعله من الذاكرين لك، الشاكرين لك، الطائعين لك، المنيبين لك،
اللهم واجعل أوسع رزقه عند كبر سنه، اللهم واغفر له جميع ما مضى من ذنوبه، واعصمه فيما بقي من عمره، وارزقه عملا زاكيا ترضى به عنه، اللهم تقبل توبته، وأجب دعوته
اللهم إنا نعوذ بك أن ترده إلى أرذل العمر، اللهم واختم بالحسنات أعماله.... اللهم آمين
اللهم وأعنا على بره حتى يرضى عنا فترضى، اللهم اعنا على الإحسان إليه في كبره
اللهم ورضه علينا، اللهم ولا تتوفاه إلا وهو راضي عنا تمام الرضى، اللهم واعنا على خدمته كما ينبغي له علينا، اللهم اجعلنا بارين طائعين له،
اللهم ارزقنا رضاه ونعوذ بك من عقوقه، اللهم ارزقنا رضاه ونعوذ بك من عقوقه، اللهم ارزقنا رضاه ونعوذ بك من عقوقه، اللهم آمين، اللهم آمين، اللهم آمين، وصلى الله على نبينا محمد وعلى آله و صحبه ومن تبعهم بإحسان إلى يوم الدين..
Subscribe to:
Posts (Atom)
